CRISPR-Cas9 Spring Batch Application

 // This application models the CRISPR-Cas9 gene-editing process as a Spring Batch job.

// The genome is treated as a list of DNA base pairs, and the editing process is a batch job
// that reads, processes, and "writes" changes to that data.

import org.springframework.batch.core.Job;
import org.springframework.batch.core.Step;
import org.springframework.batch.core.configuration.annotation.EnableBatchProcessing;
import org.springframework.batch.core.configuration.annotation.JobBuilderFactory;
import org.springframework.batch.core.configuration.annotation.StepBuilderFactory;
import org.springframework.batch.item.ItemProcessor;
import org.springframework.batch.item.ItemReader;
import org.springframework.batch.item.ItemWriter;
import org.springframework.beans.factory.annotation.Autowired;
import org.springframework.boot.SpringApplication;
import org.springframework.boot.autoconfigure.SpringBootApplication;
import org.springframework.context.annotation.Bean;
import org.springframework.context.annotation.Configuration;
import java.util.List;
import java.util.LinkedList;
import java.util.concurrent.atomic.AtomicInteger;

// Main entry point for the Spring Boot application
@SpringBootApplication
public class CrisprCas9Application {
    public static void main(String[] args) {
        SpringApplication.run(CrisprCas9Application.class, args);
    }
}

/**
 * Represents a segment of DNA with its sequence and location.
 */
record DnaSequence(String sequence, long location) {}

/**
 * Represents a processed DNA sequence after the editing action.
 */
record EditedDnaSequence(long location, String originalSequence, String editedSequence, EditAction action) {}

/**
 * Defines the type of gene-editing action.
 */
enum EditAction {
    KNOCK_OUT,    // Simulates deleting a gene or sequence
    KNOCK_IN      // Simulates inserting a new gene or sequence
}

/**
 * Main Job Configuration for the CRISPR-Cas9 batch process.
 * This class defines the overall job and its single step.
 */
@Configuration
@EnableBatchProcessing
class CrisprCas9BatchConfig {

    @Autowired
    private JobBuilderFactory jobBuilderFactory;

    @Autowired
    private StepBuilderFactory stepBuilderFactory;

    // Defines the entire CRISPR-Cas9 job
    @Bean
    public Job crisprCas9Job(Step geneEditingStep) {
        return jobBuilderFactory.get("crisprCas9Job")
                .start(geneEditingStep)
                .build();
    }

    // A single step representing the gene-editing process.
    // This step combines the reader, processor, and writer.
    @Bean
    public Step geneEditingStep(
        ItemReader<DnaSequence> reader,
        ItemProcessor<DnaSequence, EditedDnaSequence> processor,
        ItemWriter<EditedDnaSequence> writer
    ) {
        return stepBuilderFactory.get("geneEditingStep")
                .<DnaSequence, EditedDnaSequence>chunk(10) // Process 10 base pairs at a time
                .reader(reader)
                .processor(processor)
                .writer(writer)
                .build();
    }

    @Bean
    public ItemReader<DnaSequence> genomeItemReader() {
        return new GenomeItemReader("GATC", "GATTACAAGATCGATTACGGACATTAGATC");
    }

    @Bean
    public ItemProcessor<DnaSequence, EditedDnaSequence> dnaSequenceProcessor() {
        return new DnaSequenceProcessor(EditAction.KNOCK_IN, "GCTACGC");
    }

    @Bean
    public ItemWriter<EditedDnaSequence> genomeItemWriter() {
        return new GenomeItemWriter();
    }
}

/**
 * ItemReader: The Guide RNA (gRNA)
 * This component reads chunks of the conceptual "genome" and is "guided" by a target sequence.
 */
class GenomeItemReader implements ItemReader<DnaSequence> {
    // A simple conceptual "genome" string to read from
    private final String genome;
    private final String targetSequence;
    private final AtomicInteger pointer = new AtomicInteger(0);

    public GenomeItemReader(String targetSequence, String genome) {
        this.targetSequence = targetSequence;
        this.genome = genome;
        System.out.println("Guide RNA initialized. Target sequence: " + targetSequence);
    }

    @Override
    public DnaSequence read() {
        if (pointer.get() >= genome.length()) {
            return null; // End the job
        }

        // Search for the target sequence from the current pointer position
        int startIndex = genome.indexOf(targetSequence, pointer.get());
        if (startIndex == -1) {
            System.out.println("Target sequence not found. Job finished.");
            pointer.set(genome.length()); // Ensure the job ends
            return null;
        }

        // Found the target. Return the DNA sequence chunk containing the target.
        // We return the target itself for simplicity.
        pointer.set(startIndex + targetSequence.length());
        System.out.printf("Guide RNA found target at location %d. Passing to Cas9.\n", startIndex);
        return new DnaSequence(targetSequence, startIndex);
    }
}

/**
 * ItemProcessor: The Cas9 Protein
 * This component acts as the molecular scissors, performing the specified edit action.
 */
class DnaSequenceProcessor implements ItemProcessor<DnaSequence, EditedDnaSequence> {
    private final EditAction editAction;
    private final String newSequence;

    public DnaSequenceProcessor(EditAction editAction, String newSequence) {
        this.editAction = editAction;
        this.newSequence = newSequence;
        System.out.println("Cas9 Protein initialized. Edit action: " + editAction);
    }

    @Override
    public EditedDnaSequence process(DnaSequence dna) {
        System.out.printf("Cas9 is processing sequence '%s' at location %d...\n", dna.sequence(), dna.location());
        String editedContent = switch (editAction) {
            case KNOCK_OUT -> "---"; // Simulate deletion
            case KNOCK_IN -> newSequence; // Simulate insertion
        };
        System.out.printf("Cas9 completed edit. New sequence: %s\n", editedContent);
        return new EditedDnaSequence(dna.location(), dna.sequence(), editedContent, editAction);
    }
}

/**
 * ItemWriter: The Cellular Repair Mechanism
 * This component takes the edited DNA and "writes" it back into the genome.
 */
class GenomeItemWriter implements ItemWriter<EditedDnaSequence> {
    private final List<String> genomeState = new LinkedList<>();

    public GenomeItemWriter() {
        // Initialize with a simple representation of the genome
        for (char c : "GATTACAAGATCGATTACGGACATTAGATC".toCharArray()) {
            genomeState.add(String.valueOf(c));
        }
    }

    @Override
    public void write(List<? extends EditedDnaSequence> editedDnaSequences) {
        System.out.println("Cellular repair mechanism is starting to write edits...");
        for (EditedDnaSequence editedDna : editedDnaSequences) {
            long start = editedDna.location();
            long end = start + editedDna.originalSequence().length();

            // Simulate the repair process by modifying the in-memory genome
            // This is a simplified representation of DNA repair
            for (long i = start; i < end; i++) {
                if (i < genomeState.size()) {
                    genomeState.set((int) i, "[EDITED]");
                }
            }
            if (editedDna.action() == EditAction.KNOCK_IN) {
                // For simplicity, we just print the insertion
                System.out.printf("Inserted '%s' at location %d.\n", editedDna.editedSequence(), editedDna.location());
            }

            System.out.printf("Repair complete at location %d. Final state is conceptual.\n", editedDna.location());
        }
        System.out.println("Cellular repair complete for this chunk.");
    }
}

Comments

Popular posts from this blog

Goldbach’s conjecture proven

Résolution de la conjecture de Goldbach

Shutdown Windows Security Threat